Some standard content:
ICS 67. 120, 30
Aquatic Industry Standard of the People's Republic of China
SC:1062-2003
Songpu silver carp
Songpucraciancarp
2003-07-30 Issued
Ministry of Agriculture of the People's Republic of China
2003-10-01 Implementation
Chapter 4, Chapter 6 and Chapter 7 of this standard are mandatory, and the rest are recommended. The foreword of this standard is the normative annex:
This standard was proposed by the Fisheries Institute of the Ministry of Agriculture
This standard was launched by the National Fisheries Standardization Technical Committee and the Ministry of Fisheries Standardization Technical Committee, and the drafting unit of this standard is Heilongjiang Fisheries Research Institute, Chinese Academy of Fishery Sciences. The main drafters of this standard: Liu Minghua, Zi Qingli, Shi Lianzhu, Ma Bo, Li Chitao SC1062—2003
1 Scope
Matsuura silver carp
SC1062—2003
This standard lists the main biological characteristics of Carassius auratus (Far, gihelio Sangpu), and divides the biological characteristics, biological characteristics and test methods. This standard is mainly for the purpose of classification and adjustment
2 Normative references
The following documents are included in this standard through the reference of the standard. For any referenced documents, all subsequent amendments (excluding erroneous contents) or revisions are not applicable to this standard. However, the parties to the agreement on this standard may use the latest version of this document. For any reference not marked with a period, the new version shall apply to this document. GB/T 1865.1 Quality inspection of farmed fish - Part 1 GR/T 18654.1 Quality inspection of farmed fish - Part 2: Staining method GB/T 1865.3 Quality inspection of farmed fish - Part 3: Determination of traits GR/T 1865.12 Classification and quality inspection of farmed fish - Part 12: Staining method 3 Name and classification 3.1 Scientific name 3.2 Classification position Cyprinifumes (Cyprinifumes, Cynerinidie, subfamily Cyprininae, species Carassius arasstus [Csamfi]) 4 Main biological characteristics 4.1 External morphological characteristics 4.1.1 Appearance 4.1.1 Short and high lateral scallops. Broad and thick head. Small head with raised back. Rounded and flat snout. Lower jaw is about the same length as the lower jaw. Bright forehead. Small, located above the head, with hard spines. Straight outside. Thick teeth. Chest not reaching the top. Shallow at the end. Upper and lower jaws are pointed. Scales are dark brown with pale edges. Body color varies with the body or ring. Back, sides and back are usually pale grey. Head is yellow and silvery. 4.1.2 Countable traits 4.1.2. 1 Dorsal energy formula: Di-:-$~1R,
4.*.2.2 Reputation compensation formula A.-5
4. 1.2. 3 Number of gills on the side of the first number: 27~-53.4 1.2.4 Natural formula 114.
4. 1. 3 Measurable traits
Different length individuals, variable values of measurable traits see 11
SC1062-2003
Total length/sample length
Body length/body
Dou Mu wood
Head length source diameter
Head length stock certificate
Xu Chang Fangzhou people
Ni structure length/spur height
4.2 Internal structural characteristics
4. 2. 1 sheng
Fig. 1 Appearance of Matsuura silver snail
Table 1 Proportion of measurable traits of different body length groups 10 04~11.42
$ nn~ 8. 9.
-.26—. *2bzxZ.net
2.34—9.7
3.52=u.u6
3.5±u.2s
4. +6. 1s
2.4516,15
6.t1_c.48
c.83ic.c.
Source is divided into two cases, the length of the posterior chamber is 1.5 times that of the anterior chamber on the right. 4.2.2 Lower pharyngeal teeth
Downward, step 44,
4. 2. 3 hip vertebra
total spine stimulation 31.
4. 2. 4 peritoneum
membrane for seeking bad color.
4.2.5 Liver
Muscle hypertrophy, soft, red, almost covering the entire digestive tract, 4.2.6 Red blood cells
17.70---9, 30
14.2·-16,40
:. 25 -.5. 33
2. 35-.3. 08
5.71 ·3.1
3.08+0.14
4. 70 + 0. 55
2.52+u.ta
7.89+t.L8
L. rs-c.cs
20.61~-2t:. H2
6. 40~24:. 1
.24=3, 02
4,23±0 2?
2.32±0.13
7, 04±c. 53
C. 76-c.cs
The average length of the nucleus of the red group was 7.c?am, the average diameter was 3.64rm, and the average volume of the nucleus was 45.8m. 2
5 Growth and reproduction
5.1 Growth
The actual length of the nucleus of the same age group is shown in Table 2. Table 2 Measured values of body length and weight of fish in different age groups Age
Weight/g
65--136
21,2--42
Age 5.2 Breeding
5. 2. 1 Age of maturity
Female fish are 2-3 years old, male fish are 2 years old, accounting for 4.6% of the whole group. 5.2.2 Breeding type
Range nuclear development.
5. 2. 3 Spawning habits
The gonads mature once a year, and the eggs are separated and laid, which are sticky eggs. 5. 2. 4 Breeding water test
1℃ water temperature 18~22
5. 2. 5 Egg carrying capacity
The egg carrying capacity of the whole group of blood is shown in Table 3.
-42~167
:23·-154
Table 3 Egg carrying capacity of individuals in different age groups
Age/repair
Body weight%
Absolute egg carrying capacity/release
State to state egg carrying capacity/(grain/)
12:~155
The effect of time
bReal female more egg containing collection,
6 Molecular biological characteristics
167---215
19 G-2 E
105~247
PCR map of pseudotyped tissue identification VA 2.SJM
M——External, quantitative standard
Figure 2 PCR map of primer X12902 for amplification of PCR detection of tissue DNA SC:1062—2003
2u3--338
31600--65 500
SC1062—2003
Primer, X12902 amplified 11ubp segment is unique to Matsuura Ginqing.7 Cytogenetic characteristics
Somatic cell chromosome number = 1:
Forbidden chromosome group type formula: 3m=21m+37sm+25.,NF=372.Matsuura silver beard staining will group type as shown in the figure%,
Bacteria clinical disk public Xisi clothing product Wenwei version
Aidou Tianzhen Zhen Shangguo Haomei product Zhengju
AA product A product point drop AA most product crystal A person classic easy power love chicken spring high inner blood charm for wind base blood enzyme record blood show egg its island blood product
AnMA brand H# office one
China people sea
8 inspection method
8.1 Sampling
Ae C disease
Figure 3 Chromosome phase type of Songpu silverworm
According to the provisions of GR/T18654.2.
8.2 Character determination
According to the provisions of K/118654.3.
8.3 Determination of erythrocyte nuclei
8, 3.1 Preparation of blood smears
Blood was collected from the fish veins without heparin, 0.ml of blood was collected per person. The blood smears were made into glass slides, fixed with Nolte reduction (3:1 sodium chloride: ice water) for 1 hour, and then fixed with Giemsa solution. The preparation of Giemsa solution is as follows: 6.5.8.3.2 Measurement of erythrocyte diameter
Under a microscope and a 11×1 microscope, the long and short diameters of 11 erythrocyte grids in the blood smear of the fish were measured, and the half-mean of the diameter was taken.
3.3 Calculation of erythrocyte nucleus volume
The nucleus of the cell was calculated according to formula (1).
V=4/R\5
Wherein,
volume value, in cubic micrometers): a
short radius, in micrometers (r)
long radius, in micrometers (m):
8.4 Polymerization chain reaction (PCR) analysis
8. 4. 1 Genomic DNA Extraction of SC1062-2C03 Take 0.3g of celery spherical DNA, decompose it into 200g/ml-3ml of protein containing tris(DTA).O/LP8.:12-aminobutyric acid>0.5%, and incubate at +50℃ for 3h. Use aldehyde/tris(25:24:1) to extract the residue, and reduce the volume of anhydrous ethanol by 2 times. Centrifuge at 400/min for 2 hours to remove all the residues. Heat the precipitate, add TE solution, trimethylol-HCI solution (Tirs-HCl), 10 μmol/T.FEDTA, pH 6.0.1 μmol/La, 30 μL to dissolve DNA. Store in a refrigerator at 4°C for future use. 8.4.2 Primer (X120) Primer sequence: CCAGGCCTGAAGTACCACAT3R: CACGAGGTGATGGATGACTG 8.4.3 PCR reaction system: 25% risH, 1% potassium hydroxide, 0.5% MgCl, 0.1% gelatin, 0.2% primers, 1% nucleic acid, 1% ATP, 1% CTP, 1% TPDP, and 0.1% RNA. 8.4.4 PCR amplification conditions: 94°C pre-denaturation for 8 min, 92°C denaturation for 30 s, 50°C annealing for 30 s, 72°C extension for 38 cycles, 72°C extension for 5 s. The amplified products were detected by 1.4% agarose gel electrophoresis containing ethyl acetate (EB). 8.4.5 The gel electrophoresis concentration is 1.4% agar, the gel contains 0.5 Fg/mL EBC and thiazolinone, and the electrophoresis is carried out in a humidified room at a pressure of 1 V/err.~V/em. The electrophoresis time is 2~h and the gel electrophoresis is observed on an imaging device. 8.5 Chromosome inspection (GB/T18654.12 is in accordance with the provisions of the current implementation: 8.6 Determination of test results
According to the provisions of CB/T18554.1,
SC1062-2003
A1 Preparation of electrophoretic fluid
Appendix A
(Normative Appendix)
Preparation of electrophoretic fluid and gel
Trimethylolpropane (ris154: 27.5g lignoceric acid, ethylenediaminetetraacetic acid>, i1rl/, 21: rTμH8,n). Add distilled water to 1 l.
|. 2 Preparation of gel
Add 1.4g chloroform, 5 times the electrophoretic fluid 1a3n1. Heat decomposition, add 0, 5u: TG
Tip: This standard content only shows part of the intercepted content of the complete standard. If you need the complete standard, please go to the top to download the complete standard document for free.