Home > GB > Determination of photosynthetic bacteria in biologic products
Determination of photosynthetic bacteria in biologic products

Basic Information

Standard ID: GB/T 38579-2020

Standard Name:Determination of photosynthetic bacteria in biologic products

Chinese Name: 生物产品中光合细菌测定

Standard category:National Standard (GB)

state:in force

Date of Release2020-03-31

Date of Implementation:2020-03-31

standard classification number

Standard ICS number:Mathematics, Natural Sciences >> 07.080 Biology, Botany, Zoology

Standard Classification Number:General>>Basic Standards>>A21 Environmental Conditions and General Test Methods

associated standards

Publication information

publishing house:China Standards Press

other information

drafter:Zhou Hui, Ma Aijin, Peng Hai, Jia Yingmin, Tian Yun, Hao Shuai

Drafting unit:Hunan Agricultural University, China National Institute of Standardization, Jianghan University, Beijing Technology and Business University, Wuhan Mingliao Biotechnology Co., Ltd., Beijing Sambo Technology Co., Ltd.

Focal point unit:China National Institute of Standardization

Proposing unit:China National Institute of Standardization

Publishing department:State Administration for Market Regulation National Standardization Administration

Introduction to standards:

Standard number: GB/T 38579-2020
Standard name: Determination of photosynthetic bacteria in biologic products
English name: Determination of photosynthetic bacteria in biologic products ||
tt||Standard format: PDF
Release time: 2020-03-31
Implementation time: 2020-03-31
Standard size: 6.59M
Standard introduction: Scope
This standard specifies the determination method of photosynthetic bacteria in biological products.
This standard applies to the determination of Rhodos pirillum rubrun, Rhodos pirillum fulvum, Rhodo pseudomonas palustris, Rhodobacter capsulatus and Rhodobacter sphaeroides in biological products. ||
tt||2 Normative references
The following documents are indispensable for the application of this document. For dated references, only the dated version applies to this document. For undated references, the latest version (including all amendments) applies to this document. ||
tt||GB/T6682 Specifications and test methods for water for analytical laboratories
This standard specifies the determination method for photosynthetic bacteria in biological products. This standard is applicable to the determination of Rhodospirillum rubrum, Rhodospirillum fulvum, Rhodopseudomonas palustris, Rhodobacter capsulatus and Rhodobacter sphaeroides in biological products.


Some standard content:

ICS07.080
iiiKAa~cJouakAa
National Standard of the People's Republic of China
GB/T38579—2020
Determination of photosyntheticbacteriain biologicproducts2020-03-31Issued
State Administration for Market Regulation
National Standardization Administration
2020-03-31Implementation
This standard was drafted in accordance with the rules given in GB/T1.1-2009. This standard was proposed and managed by the China National Institute of Standardization. iiiKA~cJouakAa
GB/T38579-—2020
Drafting organizations of this standard: Hunan Agricultural University, China National Institute of Standardization, Jianghan University, Beijing Technology and Business University, Wuhan Mingliao Biotechnology Co., Ltd., Beijing Samber Technology Co., Ltd. Main drafters of this standard: Zhou Hui, Ma Aijin, Peng Hai, Jia Yingmin, Tian Yun, Hao Shuai. 1
1 Scope
Determination of photosynthetic bacteria in biological products
This standard specifies the determination method of photosynthetic bacteria in biological productsiiiKA~cJouakAs
GB/T38579-—2020
This standard applies to the determination of Rhodospirillumrubrum, Rhodospirillumfuluum, Rhodopseudomonaspalustris, Rhodobactercapsulatus and Rhodobacterphaeroides in biological products. Normative references
The following documents are indispensable for the application of this document. For all dated references, only the dated version applies to this document. For all undated references, the latest version (including all amendments) applies to this document. Specifications and test methods for water for analytical laboratories GB/T6682
Terms and definitions
The following terms and definitions apply to this document. 3.1
biologicproducts
Biological products
Products obtained by biotechnology.
Note: The biological products in this standard refer specifically to products containing photosynthetic bacteria. 3.2
Photosynthetic bacteria
photosynthetic bacteria
Prokaryotes with primitive light energy synthesis systems, a general term for bacteria that can perform oxygen-free photosynthesis under anaerobic conditions. Note: Refers specifically to non-oxygenous photosynthetic bacteria, especially purple non-sulfur bacteria, belonging to Proteobacteria, Alphaproteobacteria, Rhodospirillales, Rhizobiales, Rhodobacterales, including Rhodospirilla rubrum, Rhodospirilla flavorum, Rhodopseudomonas palustris, Rhodobacter sphericalus, etc. 3.3
Multiple nucleotide polymorphism
multiplenucleotidepolymorphism; MNP Sequence polymorphism caused by multiple nucleotides in a nucleotide region. 4 Principle
The sample to be separated is diluted and inoculated in a selective culture medium, and a single cell grows and reproduces to form a colony visible to the naked eye. Count the photosynthetic bacteria in the biological product according to the colony count on the plate and the physiological and biochemical and MNP identification results of the picked colonies. Reagents or materials
All reagents used in this method are analytically pure. Unless otherwise specified, the experimental water is grade water specified in GB/T6882. 1
GB/T38579—2020
AT culture medium: see A.1 in Appendix A.
Photosynthetic bacteria isolation agar: see A.2.
Phosphate buffer: see A.3.
Gram staining solution: see A.4.
Multiplex PCR amplification and library construction kit. High-throughput sequencing kit.
Primers: see Appendix B.
Instruments
Light constant temperature incubator: illumination not less than 20001x, 30℃±1℃2 Balance: accuracy is 0.001g.
High-throughput sequencer.
Filter bottle
Homogenizer, sterile homogenization bag, homogenization cup. Water phase filter membrane: pore size 0.22μm.
Microaerobic culture tank: transparent culture container device that can maintain 1% oxygen concentration. Sterile conical flask: capacity 250ml, 500ml screw-mouth test tube: capacity 13ml.
Sterile culture dish: diameter 90mm.
Microscope: minimum 100×.
7Samples
Sampling principles
iiKA-cJouakAs
Sample collection should follow the principles of randomness and representativeness. The sampling process should follow the aseptic operation procedures to prevent all possible external contamination.
Sampling method
Samples should be collected from the same batch of products. The collection volume of each sample should meet the requirements of microbial index inspection, generally not less than 7.2.1
500g (ml).
7.2.2 For solid products with an independent package of no more than 500g or liquid products with an independent package of no more than 500ml, take the complete package. 7.2.3 For liquid products with an independent package of more than 500mL, shake or stir the liquid with a sterile stick before sampling to make it uniform, then collect an appropriate amount of samples and put them in a sterile sampling container as one sample. 7.2.4 For solid products with an independent package of more than 500g, use a sterile sampler to take appropriate amounts of samples from different parts of the same package and put them in the same sterile sampling container as one sample. 7.3
Storage and transportation of collected samples
Samples should be transported to the laboratory for inspection as soon as possible. The samples should be kept intact during transportation. The samples should be stored at a temperature close to the original storage temperature, or necessary measures should be taken to prevent the change of the number of microorganisms in the samples. 8 Test steps
8.1 Dilution of samples
TiiKA-cJouakAs
GB/T38579—2020
8.1.1 Solid samples: Weigh 25g of sample and place it in a sterile homogenizing cup containing 225ml of phosphate buffer, homogenize at 8.000r/min~10000r/min for 1min~2min, or place it in a sterile homogenizing bag containing 225ml of diluent, and beat it with a slapping homogenizer for 1min~2min to make a 1:10 sample solution. 8.1.2 Liquid samples: Take 25mL of sample and place it in a sterile conical flask containing 225mL of phosphate buffer (with an appropriate number of sterile glass beads pre-placed in the flask), mix it thoroughly, and make a 1:10 sample solution. 8.1.3 Take 1 ml of the 1:10 sample homogenate and slowly inject it into a sterile test tube containing 9 ml of phosphate buffer along the tube wall. Shake the test tube or use a sterile pipette to blow and beat repeatedly to mix evenly to make a 1:100 sample homogenate. Dilute it in sequence to prepare a 10-fold series of diluted sample homogenates.
8.1.4 Pour 15 ml~20 ml of photosynthetic bacteria separation agar medium into the plate. After the medium cools and solidifies, select 2 to 3 consecutive appropriate dilutions of sample homogenates in 8.1.3 (liquid samples may include stock solution) based on the estimation of the number of photosynthetic bacteria in the sample. Inoculate 2 sterile plates for each dilution, accurately pipette 1 ml and evenly spread it on the separation medium. 8.1.5 After the inoculum in 8.1.4 is completely absorbed by the medium, pour 5 ml~10 ml of photosynthetic bacteria separation agar medium cooled to below 46°C into the plate, and rotate the plate to completely cover the lower layer of the medium. 8.2 Culture
After the agar solidifies, turn the plate over and place it in a microaerobic culture tank at 30℃±1℃ for 5 days under light. 8.3 Colony Count
8.3.1 Observe with the naked eye and record the dilution multiple and the corresponding number of brown-red colonies. The colony count is expressed in colony forming units (cFU).
8.3.2 Select a plate with a colony count between 30 and 300 and no spreading colony growth to count the total number of colonies. For plates with less than 30 CFU, record the specific colony count, and for plates with more than 300 CFU, record as too many to count. The colony count of each dilution should be the average of two plates. 8.3.3 If one of the plates has large flake colonies, it should not be used. The plate without flake colonies should be used as the colony count for this dilution: If the flake colonies are less than half of the plate, and the colonies in the remaining half are evenly distributed, half of the plate can be counted and multiplied by 2 to represent the colony count of one plate.
8.3.4 When chain growth without obvious boundaries between colonies appears on the plate, each single chain is counted as a colony. 8.4 Identification of photosynthetic bacteria
8.4.1 Colony selection and pure culture
Pick 5 (select all if less than 5) colonies on the counting plate that are large, red, brown or yellow, smooth in surface, soft in texture, and have neat edges, and inoculate them on photosynthetic bacteria separation agar plates, place them in microaerobic culture tanks, and culture them at 30℃ ± 1℃ for 2d to 3d. 8.4.2 Identification by MNP method
8.4.2.1 DNA extraction
Extract genomic DNA from a single colony in pure culture and purify it. The ratio of the absorbance values ​​of the extracted and purified DNA solution at 260nm and 230nm is greater than 2.0: the ratio of the absorbance values ​​at 260nm and 280nm is between 1.7 and 1.9: the main band of DNA electrophoresis is obvious, with no obvious degradation; there is no obvious RNA residue. 3
GB/T38579—2020
Multiple PCR amplification and library construction
iiKA-cJouakAs
Carry out DNA quality control, multiple PCR amplification, library construction and purification according to the instructions of the multiple PCR amplification and library construction kit, and the number of multiple PCR amplification cycles is not more than 20. 8.4.2.3
High-throughput sequencing
Perform high-throughput sequencing and sequencing quality control according to the operating instructions of the high-throughput sequencing kit and high-throughput sequencer. The average coverage of high-throughput sequencing is set to more than 700 times, and the sequencing length is greater than the amplification length of the marker primer on the reference genome.
8.4.2.4 Experimental data quality control
Use photosynthetic bacteria identification software to align the sequencing data of the sample to the marker site of the reference genome, and calculate the average coverage of the marker site Cre
When C<500, it is determined that the sequencing data of the sample is insufficient, and the experiment is repeated from 8.4.2.2 or the previous steps. When C≥500, the sequencing data is determined to be qualified. 8.4.2.5 Result determination
Use photosynthetic bacteria identification software to count the number of detected markers N of photosynthetic bacteria and output the determination conclusion. If N=0, the conclusion is "the photosynthetic bacteria are not present in the tested colony". If N=1 or N=2, the conclusion is "the photosynthetic bacteria may be present in the tested colony". If ≥3, the conclusion is "the photosynthetic bacteria are present in the tested colony". For samples with the conclusion "the photosynthetic bacteria may be present in the tested colony". 8.4.2.6
Anti-pollution measures
Sample preparation, nucleic acid extraction, multiplex PCR amplification and high-throughput sequencing should be carried out in the specified area and the laboratory should be well ventilated. Instruments and equipment in different areas should be dedicated. 8.4.3 Morphological identification
Pick pure culture and perform staining and microscopic examination. The morphological characteristics of purple non-sulfur bacteria are shown in C.1 in Appendix C. 8.4.4 Carbon source utilization test
Pure culture was inoculated into A containing different carbon sources. T medium. Cultured at 30℃±1℃ for 3d~5d under light. The physiological and biochemical identification characteristics of representative genera and species of purple non-sulfur bacteria are shown in Appendix C. 8.5 Experimental data processing
8.5.1 Method for calculating colonies
The calculation of photosynthetic bacterial colonies on each plate is shown in formula (1): b
Wherein:
The number of photosynthetic bacterial colonies on each plate: a
bThe number of colonies confirmed as photosynthetic bacteria after picking: A—The number of colonies on the plate for verification: 4
....(1)
CThe number of all characteristic colonies on the plate.
8.5.2 Method for calculating the total number of colonies
iiiKA-cJouakAs
GB/T38579-—2020
8.5. 2.1 If the number of colonies on only one dilution plate is within the appropriate counting range, calculate the average of the colony counts on the two plates. Then multiply the average by the corresponding dilution factor to obtain the total number of colonies per gram (ml) of sample: 8.5.2.2
If the number of colonies on two consecutive dilution plates is within the appropriate counting range, calculate according to formula (2): EC
[(n+0.1n)d]
Where:
The number of viable bacteria of a certain photosynthetic bacteria in the sample; The sum of the number of colonies on the plates (including the plates with the number of colonies in the appropriate range): The number of plates with the first dilution (low dilution factor): The number of plates with the second dilution (high dilution factor): The dilution factor (first dilution).
.........
·(2)
If the average of all dilutions is If the number of colonies on the plates is greater than 300 CFU, the plate with the highest dilution should be counted, and the other plates can be recorded as too many to count. The result is calculated by multiplying the average colony number by the highest dilution factor. 4 If the number of colonies on the plates of all dilutions is less than 30 CFU, it should be calculated by multiplying the average colony number of the lowest dilution by the dilution factor 8.5.2.4
.
If no colonies grow on the plates of all dilutions (including the original liquid sample solution), it is calculated as less than 1 multiplied by the lowest dilution factor. 8.5.2.5
If the number of colonies on the plates of all dilutions is not between 30 CFU and 300 CFU, and some of them are less than 30 CFU or greater than 8.5.2.6
300 CFU, it is calculated by multiplying the average colony number closest to 30 CFU or 300 CFU by the dilution factor. 8.6
Report on total colony count
8.6.1 If N is 0, report as less than 1 multiplied by the minimum dilution factor. 8.6.2 When the colony count is less than 100 CFU, round it off according to the principle of "rounding off" and report it as an integer. 8.6.3 When the colony count is greater than or equal to 100 CFU, round off the third digit according to the principle of "rounding off", take the first two digits, and replace the digits with 0: It can also be expressed in the form of 10, round off according to the principle of "rounding off", and use two significant digits. 8.6.4 If all plates are spread colonies and cannot be counted, report the spread of colonies. 8.6.5 If there is colony growth on the blank control, the test result is invalid. 8.6.6 Report the sample by weight in CFU/g, and report the sample by volume in CFU/mL. 5
GB/T38579—2020
AT culture medium
Basic culture medium
MgCl·6H,O
CaCl.·2H.0
Distilled water
Trace element supplement solution
FeCl.4H,0
CoCl·6H,0
NiCl:6H,0
Cu Clg5Ho
MnCl·4H,O
NagMo0.·2H.
Na.SeO,.5H0
(Informative Appendix)
Culture medium
10mmol/L
1000mL
Dissolve the above ingredients in about 900mL of water respectively. Adjust the pH to 2~3 with 1mol/L hydrochloric acid. Make up to 1L. A.1.3
Vitamin supplement liquidbzxz.net
para-aminobenzoic acid
Biotin
Distilled water
iiiKAicJouakA
Filter through 0.22um aqueous phase filter membrane, store in a sterile container, and refrigerate. A.1.4
General Administration of Chemical Supervision
Ascorbic acid
Distilled water
Filter through 0.22um aqueous phase filter membrane, store in a sterile container, and refrigerate and protect from light. A.1.5
AT national standard and
iiiKAa~cJouakAa
GB/T38579-—2020
Before use, add 1ml of trace element supplement, 1ml of vitamin supplement and 10mL of ascorbic acid supplement to 1000mLA.1.1 basal culture medium and adjust the pH to 6.9±0.1. Filter the culture medium through a 0.22um aqueous phase filter membrane and dispense it into 13mlL sterile screw-capped test tubes, with 12mL of liquid in each tube.
People's Supervisory Committee of China
Huai City National Standard
CHCOONa·3H,O
Yeast extract
K,HPO,·3H,0
MgCl,·6H,0
Fe-EDTA solution
Agar powder
Distilled water
Sodium ethylenediaminetetraethyl iron solution
FeSO.·7H.0
Na-EDTA
Distilled water
Huai City national standard and
1000ml
Except agar, dissolve the remaining ingredients in distilled water. pH6.9. Add agar and heat to dissolve. Quantitatively pack in suitable containers, sterilize at 121℃ high pressure for 15min
GB/T38579—2020
Photosynthetic bacteria separation agar preparation method
TiiKA~cJouakAa
Determine the basic bacteria test standard before clinical use, keep warm at 46℃, add 5mL ascorbic acid to 1000mL basic bacteria test standard. Shake and mix for preparation.
Phosphate buffer diluent
Storage solution
Add about 175ul of 1mol/L potassium hydride
distilled
A.3.1.2 Preparation method
Add about 175ul of 1mol/L potassium hydride solution to adjust pH to 7.2. Add distilled product to 1000ml. Store in refrigerator.
Dilution
Add 1.25ml of distilled product to storage. Add to 1000ml, put into suitable container, and autoclave at 121℃ for 15min. A.4
Gram staining method
Crystal violet staining solution
The crystals must be completely dissolved in ethanol, then mixed with ammonium violet solution of standard grade. A.4.2
Gram's iodine solution
Potassium iodine
Distilled
A.4.2.2 Preparation
Mix potassium iodine of a certain iodine grade, add distilled solution, shake thoroughly, and add distilled solution to 300mL.A.4.3
Re-staining solution
A.4.3.1 Ingredients
95% ethanol
Distilled water
A.4.3.2 Preparation
Dissolve safflower in ethanol, then dilute with distilled water. A.4.4
Original instrument
Fix the smear on a flame. Add crystal violet staining solution, stain for 1min, wash with water, A.4.4.2
Add Gram's iodine solution, act for 1min, wash with water. iiiKA~cJouaKA
GB/T38579-—2020
Add 95% ethanol to decolorize for about 30 seconds, and wash with water; or drip ethanol all over the smear, immediately pour it off, and then drip ethanol all over the smear, decolorize for 10 seconds.
Wash with water, add safranin re-staining solution, re-stain for 1 minute, wash with water, wait to dry, and the results of microscopic examination: Gram-positive bacteria are purple, and Gram-negative bacteria are red 9
GB/T38579—2020
MNP standard notes some light table B.1.
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Mingsheng Ti Zhonghua||tt| |Mingshengti Zhonghua
Mingshengti Zhonghua
Standardized point number
(Normative Appendix)
MNP labeled primers
MNP labeled primers
Some are different
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some|| tt||Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some
Forward some
Reverse some| |tt||Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some items (5-3 end)
TiiKA~cJouakAa
GATGGGCGTCAAGGTCGA
ACCGGCTTCGGCATGAA
ATCAAGATCAACCACGAGACCCA
GAG ACGTGGATCAGGCCTTC | GACCCGGATCGATCTTG
GGCACGCTGTTCACCTTC
CTTGATGTCGCCCTTGGC
TAACGGCTGGCATTCATCGTTTA
TGATACTGGAAGTCTTGAGTA TGGCA | | tt | TCAGCGTGCTGAA
GGAAGCGCGTCTGTTCAAATAC
TCGATGACCTTCCAGTTGATGAATTC
ATGCGGGAACGCGCAGATA
ATGGTCGGAGCGAGAGGAT1min wash with water. iiiKA~cJouaKA
GB/T38579-—2020
Add 95% ethanol to decolorize for about 30s, wash with water; or drip ethanol all over the smear, pour it off immediately, and then drip ethanol all over the smear, decolorize for 10s.
Wash with water, add safranin re-staining solution, re-stain for 1min, wash with water, wait to dry, microscopic examination results: Gram-positive bacteria are purple, Gram-negative bacteria are red 9
GB/T38579—2020
MNP standard notes have light table B.1.
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Mingsheng Ti Zhonghua||tt| |Mingshengti Zhonghua
Mingshengti Zhonghua
Standardized exit point number
(Normative Appendix)
MNP labeled primers
MNP labeled primers
Some are different
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some|| tt||Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction| |tt||Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some items (5-3 end)
TiiKA~cJouakAa
GATGGGCGTCAAGGTCGA
ACCGGCTTCGGCATGAA
ATCAAGATCAACCACGAGACCCA
GAG ACGTGGATCAGGCCTTC | GACCCGGATCGATCTTG
GGCACGCTGTTCACCTTC
CTTGATGTCGCCCTTGGC
TAACGGCTGGCATTCATCGTTTA
TGATACTGGAAGTCTTGAGTA TGGCA | | tt | TCAGCGTGCTGAA
GGAAGCGCGTCTGTTCAAATAC
TCGATGACCTTCCAGTTGATGAATTC
ATGCGGGAACGCGCAGATA
ATGGTCGGAGCGAGAGGAT1min wash with water. iiiKA~cJouaKA
GB/T38579-—2020
Add 95% ethanol to decolorize for about 30s, wash with water; or drip ethanol all over the smear, pour it off immediately, and then drip ethanol all over the smear, decolorize for 10s.
Wash with water, add safranin re-staining solution, re-stain for 1min, wash with water, wait to dry, microscopic examination results: Gram-positive bacteria are purple, Gram-negative bacteria are red 9
GB/T38579—2020
MNP standard notes have light table B.1.
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Combined single lifting position according to the big data
Mingsheng Ti Zhonghua||tt| |Mingshengti Zhonghua
Mingshengti Zhonghua
Standardized exit point number
(Normative Appendix)
MNP labeled primers
MNP labeled primers
Some are different
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some
Forward Some
Reverse Some|| tt||Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction| |tt||Some in the forward direction
Some in the reverse direction
Some in the forward direction
Some in the reverse direction
Some items (5-3 end)
TiiKA~cJouakAa
GATGGGCGTCAAGGTCGA
ACCGGCTTCGGCATGAA
ATCAAGATCAACCACGAGACCCA
GAG ACGTGGATCAGGCCTTC | GACCCGGATCGATCTTG
GGCACGCTGTTCACCTTC
CTTGATGTCGCCCTTGGC
TAACGGCTGGCATTCATCGTTTA
TGATACTGGAAGTCTTGAGTA TGGCA | | tt | TCAGCGTGCTGAA
GGAAGCGCGTCTGTTCAAATAC
TCGATGACCTTCCAGTTGATGAATTC
ATGCGGGAACGCGCAGATA
ATGGTCGGAGCGAGAGGAT
Tip: This standard content only shows part of the intercepted content of the complete standard. If you need the complete standard, please go to the top to download the complete standard document for free.